1. INTRODUCTION:

A long term use of fluoride can result in emergence of fluoride-resistant oral Streptococcus sp. are including Streptococcus mutans, which strongly implicated as a basically etiological factor in dental caries. One of the important virulence defenses of these organisms is their ability to form as dental plaque on tooth surfaces. [1]The studies focus on bacterial products that contribute to each of main virulence properties, one of the consequences of a patent survey how S. mutans has adapted to surviving the oral environment [2], to defense against host factors included application of fluoride is acute of egression of fluoride resistance in microorganisms.

Fluoride-resistant strains have been discovered in several clinical studies [3]. Presently, the strains have fluoride resistant show clear phenotypic like difference sing growth, adherence, and metabolic activity compared to the fluoride sensitive strains. It was believed that these phenotypic converting was led to stable genotypic changes in the fluoride-resistant strains. the reports have explored these genotypic changes lead to many differences in fluoride resistance machines included a new mutation genes with different sequence [4]. The distinctness of fluoride-resistant in oral Streptococcus sp. may not only decrease the anti-caries effects of fluoride, but also, disrupt aggregation of oral streptococci in the oral cavity may be not only dispose fluoride effects like anti-caries, on other hand disrupt aggregation of oral streptococci in the oral cavity to attain understanding of resistance mechanisms involved fluoride resistance may be shed insight for the antimicrobial fluoride effects [5]. The family genes of fluoride exporters have reported in microorganisms such as subclass of family of SNARE-associated domain; a small membrane protein that able to camphor resistance mutants. [6][7] Genome sequencing of S. mutansUA159 strain has in charged of fluoride exporters has directly interrelated [8] In this study, we attempted to detect and explore fluoride-resistance-related hypothetical gene like mutant gene in oral Streptococcus mutans. The involvement of the gene in fluoride resistance has been confirmed by sequencing analysis, this gene participated in expression of fluoride resistance proteins belong to microflora like S. mutans isolate from oral cavity. The hypothetical gene confirmed to do fluoride exporter machines in bacterial cell membrane for fluoride resistance [9].

2. MATERIALS AND METHODS:

2.1-Bacterial identification and fluoride resistance level determination:

Streptococcus mutans MAW was isolated by using nutrient agar media, a DNA extraction set was employed for identification was confirmed through genotypic diagnosis of microorganisms species by specific 16S rRNA gene primer (16S rRNAF. (5‘GCGACGATACATAGCCGACC‘3), 16S rRNAR. (5‘CTCGGTCAGACTTTCGTCC‘3) [10][53]. The PCR reaction consist of (25µl) PCR reaction mixture, it was following an initial 4-min hold at 94°C, a 16S rRNA gene fragment was amplified by 30 cycles of denaturing at 94°C (30 s), annealing at 55°C (30 s), and extension at 72°C (45 s). [11] (Fig.1).

The fluoride resistant of Streptococcus mutans MAW was examined by culturing to an optical density at (OD₆₀₀) (2 * 10⁷ cells/ml) of the bacteria by streaking the nutrient agar plates containing gradient concentrations of sodium fluoride (500, 1000, 1500, 2000) ppm of sodium fluoride per ml) in order to show two different levels of fluoride resistance. Plates were incubated at 37°C for 45hr., growth colonies were indicated to positive result. The higher resistance colonies for fluoride was selected and inoculated in broth culture with concentration of sodium fluoride equal to 2000ppm/ml, then bacteria were incubated until early exponential phase at 37C˚. To evaluate bacterial proliferation at (OD₆₀₀) (4* 10⁵ cells/ml), more specifically, bacteria was reducing five more times, corresponding to fluoride resistance generation. The hypothesis was that mutants carrying FRAM gene caused diminished FR expression [12][52].

2.2- Identification of Streptococcus mutans strain and FRAM gene sequencing for phylogenic analysis:

The resistance Streptococcus mutans MAW colonies were selected from higher fluoride resistance concentration plates have 1500, 2000ppm/ml NaF, a DNA extraction was employed to amplify FRAM gene by specific-gene primer at conventional PCR with FRAM gene primers RF.(5’-

CATATGCTTAATCCCCATCTAATGCT- ‘3) R. (5‘-GCATGCACTGATATTACTGGCTATTTA- ‘3). Using of Exo SAP-IT reagent as per manufacturer’s instructions to PCR product were purified and sequenced when used specific forward and reverse primers. Sequencing reactions were performed with Big Dye Terminator cycle sequencing ready reaction kit reagents on an ABI Prism DNA sequencer. Sequences were appeared, edited, and identified using (Clone manager demo _9.2) software program to comparing alignments with conference sequences database in NCBI Gene Bank reference sequences. [12][13]. The sequence was analyzed in the nucleotide databases led to submitted to Gen Bank. Related sequences of Streptococcus mutansUA159 were obtained from the NCBI’s nucleotide database (www.ncbi.nlm.gov/nucleotide) and included in the multiple alignment employed (clone manager demo_9.2) software program [14]. The evolutionary history was inferred using the Neighbor-Joining method among ten FR genes in NCBI database [15] via (clone manager demo _9.2) software with 1000 bootstrap replicates [16]. The evolutionary distances were computed using the Jukes-Cantor method and run at MEGA6 model.

2.3- Genes expression assay:

The RNA was extracted from Streptococcus mutans MAW which was fed with higher NaF concentrations (control without NaF.). Isolated RNA integrity an average optical density (OD) OD₂₆₀/OD₂₈₀ nm absorption ratio of range 2.12. Therefore, concentrations of 25 ng cDNA (= reverse transcribed total RNA) per µl were achieved [17][18]. To Real-time PCR expression highly purified salt-free primer for especial gene (FRAM gene) and housekeeping gene (16SrRNA gene) RT-PCR was performed using a standard TaqMan^® PCR kit protocol. The 10µl PCR included 0.67µl RT product, 1× TaqMan^® Universal PCR Master Mix (Applied Biosystems), 0.2 µM probe, 1.5µM forward primer and 0.7µM reverse primer. The reactions were incubated at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The threshold cycle (C_T) is known as the fractional cycle number when the fluorescence passes the fixed threshold [19].

For explicated mathematical model is necessary to determine the CPs for each transcript using Light Cycler Software 3.5 (Lin Reg PCR" to "Dynamic) [20].

3. RESULTS:

3.1- Bacterial 16S rRNA identification:

Streptococcus mutans MAW of oral isolate from Iraqi dental patients was performed to confirm their identification species by amplifying of the 16S rRNA gene. Primers of conserved region of 16S rRNA were designed and used for amplification of DNA, then PCR products were separated on 1% agarose gel, the electrophoresis results were documented in (Figure 1), they were demonstrated DNA of S. mutans MAW species given16S rRNA gene band with 125 bp [10].

Figure (1): Agarose gel electrophoresis for amplification of 16SrRNA gene of S. mutans MAW on (1%) agarose gel, 70 voltage for 90 minutes. Lane (1): DNA marker Ladder (100bp). Lane (C^-): Amplicon of 16S rRNA primer with S.salivarious . Lane (2): Amplicon of 16S rRNA gene (125bp) of S.mutansMAW.

3.2- Higher level of fluoride resistance of Streptococcus mutans MAW

Streptococcus mutans MAW bacteria was showed the highest Fluoride tolerance (NaF ) at 2000ppm/ml, it was selected for further studies. The results detected the specificity of fluoride resistance in bacterial phenotype that given quantitative determination of turbidity for S. mutans MAW through bacterial proliferation at NaF culture as shown in (table 1). The results appeared using NaF was caused releasing in bacterial growth to understand practically roles of the confirmed variant in the S.mutans MAW to fluoride-resistant until early exponential phase according to fluoride-resistant genes activity of mutated intergenic region may be let to appear mutant strain [21][32].

(Table 1): - Sodium Fluoride effects on S. mutans MAW growth

Growth type	Growth value (O.D₆₀₀) (cell /ml)	Incubation period (hr.)
S. mutans MAW culture without NaF	2 x 10⁷	18
S. mutans MAW with 2000 (µg/ml) NaF	4 x 10⁴	48

3.3- Identification of fluoride-resistance-related genes in S. mutans MAW

In the present study the fluoride resistance gene was used in bacterial diagnosis through amplification of conserved region of SNARE family genes by using specific Primers were designed and used for amplification of DNA by PCR, the products were separated on 1% agarose gel (Figure 2), the result demonstrated that S. mutans MAW has hypothetical gene band with 400bp.

Figure (2): Agarose gel electrophoresis for amplification of FRAM geneof S. mutans MAW on (1%) agarose gel, 70 voltage for 90 minutes. Lane (1): DNA marker Ladder (100bp). Lane (C^-): Amplicon FRAM geneprimer with S.salivarious. Lane (C⁺): Amplicon FRAM geneprimer with sensetive S. mutans MAW. Lane (2): Amplicon of FRAM gene(400bp) with resistance S. mutans MAW.

3.4- The sequencing analysis of fluoride resistance genes

The sequencing results appeared a new FRAM gene in S. mutans MAW have 400 bp and 44% long similarity with blast gene bank of S. mutans UA159(ID: CP007016.1) as shown in (Figure 3 A) [22][13][14]. Sequence similarity analysis was run by (ClonemanagerDemo_9.2program) the revealed genes which named (hypothetical gene) provisional gene was included overlapping gene belonged to SNARE-associated domain family genes, SNARE-like motif present coded to bacterial proteins responsible to inhibitory function for NaF toxicity, it considerate one of bacterial cell wall machines for bacterial resistance were promoting from SNARE -associated domain family genes [23]. FRAM geneof S. mutans MAW ishypothetical genes are responsible for catalyzes the conversion of charismatic to preheated in the pathway of tyrosine and phenylalanine biosynthesis [24][25][26][54] which responsible about fluoride resistance by unknown enzymes [26], mostly it are negatively regulated by tyrosine, tryptophan and phenylalanine and belonged to SNARE family genes (Gene bank PRK07248 is a number of the super family cl00693) (Figure3 B).

Differentiation modeling can produce homologous structures for many of the remaining sequences having unknown structures [27][3], but still in many cases is unable to identify good template structures because of inadequacies in sequence matching that mutant FRAM gene has identify 49% to FR gene of S. mutans UA159 (ID: CP007016.1) came to low similarity 44%. Sequence matching is really important because it is a highly efficient key to compare proteins (genes),[28] identify protein (gene) functions and permits rapid comparisons and analyses of whole genomes. Therefore, the predicating FRAM protein matrix has 50 amino acid got similarly 80% alignment with S. mutans UA159 FR proteins using BLOSUM 62 matrices alignment (http///G:/today/SIM/Alignment/Tool/Protein/Sequences.html) [28]. These proteins pairing had high structural similarity but low genes sequence similarity, matching sequence can be sufficiently informative about the effects of mutations. [29][30][31] Many studies would have observed a higher percentage of overlaps genes called “hypothetical.” Coding to unknown proteins [32], to investigate about hypothetical genes account for 53% of all annotated genes and are somewhat less likely to overlap than are remaining genes, the information explain FRAM gene has high verity sequence was correlated with mutation occurrence . The main peculiarities of the overlaps, such as quantity and quality are analogous between hypothetical and non-hypothetical groups [33][34][52]^.Overlapping genes are appeared abnormal within a genome concluded (84%) of overlapping genes occur on the same strand in shape (tandem overlaps,→→)with some remaining (16%) overlaps occurring on opposite DNA strands in term (antiparallel overlaps,→←or←→)*[9][35].

Figure (4): A- Amplification and sequencing of (FRAM gene) in S. mutans MAW bacteria,B - The similarity of FRAM gene sequence length is (44%) and identity is (49%) between S. mutans MAWand S. mutans UA159 (ID: CP007016.1) .

3.5-FRAM gene submission in NCBI and phylogenetic tree:

The bacterial strain was identified up to other NCBI fluoride resistance species level by FRAM gene sequence analysis .The sequenced data obtained were edited a new data , aligned, and submitted to the NCBI GenBank for accession number became S. mutans MAW (ID: LC431527), that the detection show this gene belonged to unknown hypothetical proteins, generally they are negatively regulated by tyrosine, tryptophan and phenylalanine and belonged to SNARE family genes (Gene bank PRK07248 is a number of the superfamily cl00693) [36][23][25] (figure 4). Notably, homology searches with the FRAM gene sequence have returned only low-similarity hits was 44% [37][38], the closest matches (which all were putative FR genes from NCBI strains) shared 49% sequence identity were conducted using (clone manager demo _9.2) model .

Figure (4): -The information page of FRAM gene 400bp submission of S. mutans MAW and the authors affinity in NCBI.

Specifically, all cases always attitude where protein manifestation alignment match but sequences gene do not necessary match well are resolved. Phylogenetic analyses and multiple-sequence alignment were conducted using MEGA6 model, the phylogenic tree structure was mainly appeared nearest to S. mutans UA159 (ID: CP007016.1)than other groups that it take branched cluster of tree were closely related (ranging 20 nucleotide substitutions per site [nss⁻¹], respectively. Neighborhood graduation came from the comparison between S. mutans isolates have been recorded in the National Center Biotechnology Information (NCBI) to appear they have under sequence respectively with source of isolation and showed compatibility(figure5).

Figure (5): Genogram showing phylogenetic relations of the promising oral Streptococcus mutans MAW has closely related type and genetic distance with other fluoride resistance strains retrieved from NCBI GenBank. The GenBank accession numbers of the reference strains are explained in parentheses. Horizontal bars in the genogram represent branch length. Similarity of the neighboring full length of FRAM gene sequences have been indicated by bootstrap values. Distance matrix was calculated using Mega6 model. The scale bar indicates 20 substitutions per nucleotide position [nss⁻¹].

3.6- FRAM gene expression:

The study takes care to demonstrate mRNAs for FRAM gene such as SNARE family genes (hypothetical gene) was upregulated by fluoride resistance presetting in bacterial media. When S. mutans MAW was grown without NaF (control) and with 1500, 2000ppm NaF founding was compared, the bacterial resistance expression pattern when fluoride absenting didn’t appear and it just showed expression increasing relevant to NaF presenting, when it acts as a genes stimulator in growth culture. Real-time RT-PCR data demonstrated FRAM gene expression was quantified and described the errors related to common practice of single control [39] normalization strategy based on single housekeeping gene (16SrRNAgene) leads to erroneous normalization up to 5.25 fold in this analysis. In conclusion, the S. mutans MAW cells at early, late exponential, and stationary phases were collected and subjected to whole RNA extraction, DNase treatment, cDNA synthesis [40] (Figure 6 A, B), real-time PCR has shown 2^∆∆Ct software method was used to calculate relative gene expression [41][42][36], the expression compered between NaF concentration (2000ppm) was grown up 5.25-fold higher than bacterial growing in (1500ppm), according to control when fluoride was absent. The results confirmed that S.mutans MAW acquired fluoride resistance through higher expression of overlapping fluoride resistance gene, constitutively higher activity of hypothetical gene (Figure 6 C).

Figure (6): A- melting curves of FRMA gene and housekeeping gene 16SrRNA during the amplification program melts the unspecific Light Cycler PCR products. B- The effect of fluorescence acquisition in samples segment at elevated temperatures. SYBR Green I acquisition at 75°C in the 3rd segment and one “negative control ”.C- The Folding change in FRAM gene expression in S. mutans MAW when it has grown with NaF (1500,2000) ppm/ml and the gene expression compared with control when bacteria has grown without NaF concentration.

4. DISCUSSION:

Many mechanisms may play roles in the antimicrobial activity of fluoride are included inexpensive physical and chemical procedures have been introduced for F removal, such as electro-chemical methods, adsorption operations, and ion exchange ways [3][5]. This study has been applied to identify and study one Fluoride-resistant gene responsible about one evidenced mechanism to support this hypothesis in dental S. mutans MAW, which is detected contrast to transient fluoride resistance is believed to be due to chromosomal mutations. [14][16]

Last a few years, multiple gene mutations have explored in a fluoride-resistant strains [32]. These recent studies brought a new concepts or candidates for the mechanism of fluoride resistance is not only the antimicrobial target sites of fluoride, but also particular sites are involved fluoride resistance.[32,14]The dental S. mutans MAW are classified according to its 16SrRNA gene sequences, The present fluoride resistance phenotype when the bacteria was cultured at 1500, 2000ppm NaF, it showed The differences in the fluoride-resistance level replaced to genes type responsible to mechanism differentiated and examined in order to detection the relationship between the type of this gene and the fluoride resistance genes founding (table 1).The study suggests that oral S. mutans MAW possesses SANAR-family genes contain hypothetical gene like over-lapping genes kind which are associated with fluoride resistance observed through of PCR amplified to gene fragment and separated in 1% gel agarose appeared length 400bp. The sequence analysis for 400bp fragment and similarity analysis (clone manager demo _9.2) was leaving to 44% strand length similarity after cooperated with Streptococcus mutans UA159 and other NCBI data base (figure 4), its lead to discover the type of gene is for SNARE family genes responsible fluoride exporter machines such as one of bacterial cell wall changing genes.

The work investigation studies detected that, FRAM gene is annotated as ‘hypothetical gene, of bacterial cell wall genes were included SNAR –family genes, It could assume enclose to the remaining genes are either homologous to genes of unknown function, therefore, it has identity 49% compared with NCBI database. It is often unclear whether they encode actual proteins, the confront genes are commonly coded to as `hypothetical', `uncharacterized', proteins. A general prediction of its function can be often made based on a conserved sequence modifying and mutation, subtle sequence similarity to a previously characterized protein or the presence of diagnostic structural manifestations [43][23][36]. Most reports have supported the hypothesis of protein - protein interactions data reported a high rate of positive interactions [44][45]. As well as, protein - protein interactions alignment typically offer the exact structure of the protein in BLOSUM62 take up matrices alignment 80% amino acid similarity compared with Streptococcus mutans UA159 amino acid hypothetical proteins matrices in whole genome [45][46][47][52], in essence, functional characterizations can be obtained from genome wide protein interaction data through a new matrices alignments. [46] At least, the gene function could come from genome context analysis, phyletic patterns, of similarity lengths interaction NCBI data using PSI-BLAST after gene submission, [46][48][23] led to two more general functional investigations that were not made from sequence analysis alone but also we have taken a close sight on FRAM gene expression was confidently detected at the mRNA levels. these findings support a novel role for the FRAM gene products in S. mutans MAW accumulation and suggest that FRAM expression in this oral pathogen is subject to complex mechanisms of control imposed by growth phase, dietary F, and other factors present in the plaque environment [49][53][54].

Computational methods, including sequence analysis, phyletic patterns, domain fusions, structural threading of the branch lengths Similarity and gene neighborhoods can and should be used for prediction [50][51] of the likely mutation properties of this gene through direct experimentation because the furthest genetic distance between FRAM gene of S. mutans MAW and other NCBI data was 20 [nss⁻¹] [52][53][54].

5. CONCLUSION:

We conclude that fluoride exporter confers fluoride resistance to oral S. mutans MAW, in addition, using sequencing analysis was able to cover genetic changes in the genome of a fluoride-resistant strain that does not belong to the other fluoride resistance class. These findings can provide new sights into mechanisms of microbial fluoride resistance, its will be important for developing F^- removing engineered bacteria in the future. To the best of our knowledge, it is the first report on NaF absorption by the bacterial strains.

6. KNOWLEDGE:

The results described in this article was supported by Department of Biology, College of Science, University of Baghdad, like any rating research for instructors as annual achievements in their scientific field.

7. CONFLICTS OF INTEREST:

The authors declare that there are no conflicts of interest.

8. REFERENCES:

1. Yoshida A, Kuramitsu HK. Multiple Streptococcus mutans Genes Are Involved in Biofilm Formation. Apply of Environment Microbiology, 2002;68(12):6283–91.

2. Jeffrey S. McLean. "Advancements toward a systems level understanding of the human oral microbiome "Frontiers in Cellular and Infection Microbiology, 2014;4(98).

3. Chen F, Wang D."Novel technologies for the prevention and treatment of dental caries: a patent survey". Expert Opin Ther Patients. 2010 ;20(5):681–94.

4. Ten Cate JM. "Fluorides in caries prevention and control: Empiricism or science". Caries Research. 2004; 38(3):254–7.

5. Van Loveren C, Liao Y, Brandt BW, Crielaard W, Li J, Deng DM. "Fluoride resistance in Streptococcus mutans : a mini review" . Journal Oral of Microbiology. 2017;9(1):1344509. Available from: https://doi.org/10.1080/20002297.2017.1344509.

6. Jenny L. Baker, Narasimhan Sudarsan, Zasha Weinberg, Adam Roth, Randy B. Stockbridge, and Ronald R. Breaker" Widespread Genetic Switches and Toxicity Resistance Proteins for Fluoride". Science, 2014; 9(1):233–5.

7. Breaker RR. "New insight on the response of bacteria to fluoride". Caries Research. 2012;46(1):78–81.

8. Najar F, Zhu H, Mc Shan WM, Lin S, Savic G, White J, et al." Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen". Proceedings of the National Academy of Sciences of the United States of America. 2002;99(22):14434–9.

9. Johnson ZI, Chisholm SW. "Properties of overlapping genes are conserved across microbial genomes". Genome Research. 2004;14(11):2268–72.

10. Browning DF, Busby SJW. "The regulation of bacterial transcription initiation". Nature Reviews Microbiology. 2004;2(1):57–65.

11. Igarashi T, Yamamoto A, Goto N." Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction". Oral Microbiol Immunology. 1996 ;11(5): 294-8.

12. Chansley PE, Kral TA. "Transformation of fluoride resistance genes in Streptococcus mutans". Infection Immunology. 1989;57(7):1968–70.

13. Atheer A.M. "Coloning and overexpression of Lactobacillus acidophilus bile salt hydrolase gene A (bshA) in Escherichia coli". MSc. thesis, Kahraman Marash sutcu Imam University, Turkey. 2014.

14. Rice KC, Turner ME, Carney O V, Gu T, Ahn S. "Modification of the Streptococcus mutans transcriptome by LrgAB and environmental stressors". Nature Reviews Microbiology Genome Journal. 2017; 28;3(2): e000104.

15. Saitou N, Nei M. "The Neighbor-joining Method: A New Method for Reconstructing Phylogenetic Trees". 1987;4(4):406–25.

16. Felsenstein J. Phylogenies and the Comparative Method. The American Naturalist. 2002;125(1):1–15.

17. Bustin SA. “Absolute quantiﬁcation of mRNA using real-time PCR”. Journal of Molecular Endocrinology .2000; 25, 169–193.

18. Yilmaz A, Ilke H, Alp E, Menevse S. “Real-Time PCR for Gene Expression Analysis”. Polymerase Chain React. 2012;12: 229-254.

19. Choi J, Treglown JS, Huang Y-CC, Ellen RP, Senadheera MD, Spatafora GA, et al. “A VicRK Signal Transduction System in Streptococcus mutans Affects gtfBCD, gbpB, and ftf Expression, Biofilm Formation, and Genetic Competence Development “. Journal of Bacteriology, 2005;187(12):4064–76.

20. Stockbridge RB, Weinberg Z, Williams C, Lim H-H, Otten R, Shane T, et al. Fluoride resistance and transport by riboswitch-controlled CLC antiporters. Proceedings of the National Academy of Sciences of the United States of America, 2012;109(38):15289–94.

21. Sylva GL, Smoot JC, Musser JM, Sturdevant DE, Smoot LM, Somerville GA, et al. “Global differential gene expression in response to growth temperature alteration in group A Streptococcus sp”. Proceedings of the National Academy of Sciences of the United States of America, 2002;98(18):10416–21.

22. Wesolowski J, Paumet F. “SNARE motif: A common motif used by pathogens to manipulate membrane fusion”. Virulence, 2010;1(4):319–24.

23. W PA, Rippert P, Puyaubert J, Grisollet D, Derrier L, Matringe M. “Tyrosine and Phenylalanine Are Synthesized within the. American Society of Plant “Biologists, 2009;149 :1251–60.

24. Luo H, Lin Y, Gao F, Zhang C, Zhang R. DEG 10, an update of the database of essential genes that includes both protein-coding genes and noncoding genomic elements. Nucleic Acids Research, 2014;42:574–80.

25. Kolker E, Purvine S, Galperin MY, Stolyar S, Goodlett DR, Nesvizhskii AI, et al. “Initial Proteome Analysis of Model Microorganism Haemophilus influenzae Strain Rd KW20”. Journal of Bacteriology, 2003;185(15):4593–602.

26. Akerley BJ, Rubin EJ, Novick VL, Amaya K, Judson N, Mekalanos JJ. “A genome-scale analysis for identification of genes required for growth or survival of Haemophilus influenza”. PNAS,2001;99(2):966-71.

27. Leelananda SP, Kloczkowski A, Jernigan RL. “Fold-specific sequence scoring improves protein sequence matching. BMC Bioinformatics”. BMC Bioinformatics, 2016; 17:328

28. Sander C, Marks DS, Hopf TA, Colwell LJ, Pagnani A, Sheridan R, et al. “Protein 3D Structure Computed from Evolutionary Sequence Variation”. PLoS One. 2011;6(12): e28766.

29. Jia K, Jernigan RL. “SeqStruct : A New Amino Acid Similarity Matrix Based on Sequence Correlations and Structural Contacts Yields Sequence-Structure Congruence. Bio Rxiv”. Jernigan Laboratory, 2018 .

30. Greener JG, Sternberg MJ. “Structure-based prediction of protein allostery”. Currentopine Structure Biology. 2018;50: 1–8. http://dx.doi.org/10.1016/j.sbi.2017.10.002

31. Victoria A. Feher, Jacob Durrant , Adam T. Van Wart1, and Rommie E. Amaro Computational approaches to mapping allosteric pathways . NIH Public Access. 2015;9629: 98–103.

32. Liao Y, Chen J, Brandt BW, Zhu Y, Li J, Van C. “Identification and Functional Analysis of Genome Mutations in a Fluoride-Resistant Streptococcus mutans Strain”. Plos one ,2015;1–13.

33. Tatusov RL, Galperin MY, Natale DA, Koonin E V. “The COG database: a tool for genome-scale analysis of protein functions and evolution. Nucleic acid research” BMC Evolutionary Biology, 2000; 28(1):33–6.

34. Sabath N, Graur D, Landan G. “Same-strand overlapping genes in bacteria: compositional determinants of phase bias”. Biology Direction ,2008;10:1–10.

35. Lane O. “Stability and evolution of overlapping genes”. Evolution, 2000; 54(3):731–739.

36. Frishman D. “What we have learned about prokaryotes from structural genomics”. OMICS, 2003; 7, 211–224.

37. Thomas,G.H. “Completing the E.coli proteome: a database of gene products characterized since the completion of the genome sequence”. Bioinformatics, 1999;15: 860-861.

38. Vytautas P., ius,a Justas Vaiteku_ nas,a Jonita Stankevicˇiu_ te˙ ,a Renata Gasparavicˇiu_ te˙ ,a Rolandas M. ,. “Catabolism of 2-Hydroxypyridine by Burkholderia sp. Strain MAK1: a 2-Hydroxypyridine 5-Monooxygenase Encoded by hpd ABCDE Catalyzes the First Step of Bio-degradation”. Applied and Environment Microbiology Journal, 2018; 84 (11): 1-15.

39. Warrington JA, Nair A, Mahadevappa M, Clara S, Janet A, Nair A, et al. “Comparison of human adult and fetal expression and identification of 535 housekeeping / maintenance genes”. Physiological Genomics ,2000;2:143–147.

40. Vandesompele J, Preter K De, Poppe B, Roy N Van, Paepe A De. “Accurate normalization of real-time quantitative RT -PCR data by geometric averaging of multiple internal control genes”. Genome Biology, 2002;3 (7):1–12.

41. Livak KJ, Schmittgen TD.” Analysis of Relative Gene Expression Data Using Real- Time Quantitative PCR and the 22DDCT Method”. Methods. 2001;25: 402-408.

42. Shemesh, M.; Tam, A.; Feldman, M.; Steinberg, D. “Differential expression profiles of Streptococcus mutans ftf, gtf and vicR genes in the presence of dietary carbohydrates at early and late exponential growth phases”. Carbohydrates. Research. 2006, 341, 2090–2097

43. Volz K. “A test case for structure-based functional assignment: The 1.2 Å crystal structure of the yjgF gene product from Escherichia coli”. Protein Science, 2009;8(11):2428–37.

44. Pitre S, Dehne F, Chan A, Cheetham J, Duong A, Emili A, et al. “PIPE: A protein-protein interaction prediction engine based on the re-occurring short polypeptide sequences between known interacting protein pairs”. BMC Bioinformatics. 2006;7(365):1–15.

45. Sprinzak E, Sattath S, Margalit H. “How Reliable are Experimental Protein – Protein Interaction”. Journal of Molecular. Biology,2003; 327: 919–923.

46. Xenarios I. “DIP, the Database of Interacting Proteins: a research tool for studying cellular networks of protein interactions”. Nucleic Acids Research. 2002;30(1):303–5.

47. Bujnicki JM. “Protein-structure prediction by recombination of fragments”. Chemical Bio-Chemistry. 2006;7(1):19–27.

48. George A. Khoury, Adam L., Firas K., Hongyi Z., Gaurav C., Jaume etal. “WeFold: A Coopetition for Protein Structure Prediction”. Proteins, 2014;71(11):3831–40.

49. Forssten SD, Björklund M, Ouwehand AC. “Streptococcus mutans caries and simulation models”. Nutrients. 2010;2(3):290–298.

50. Streckfuss JL, Horton IM, Dreizen S, Brown LR, White JO. “Effect of Continuous Fluoride Gel Use on Plaque Fluoride Retention and Microbial Activity”. Journal Dentistry Research. 2010;62(6):746–51.

51. Maglott D, Ostell J, Pruitt KD, Tatusova T. “Entre gene: Gene-centered information at NCBI”. Nucleic Acids Research, 2011;35:26–31.

52. R. Khan, H. V. Rukke, H. Høvik, H. A. Åmdal, T. Chen,b D. A. Morrison,c F. C. Petersena . “Comprehensive Transcriptome Profiles of Streptococcus mutans UA159 Map Core Streptococcal Competence Genes”. Systems TM ,2016;1 (2): e00038-15.

53. Carricato WM, Castilla EE, Noel JB, Vieira AR, Schulhof LP, Weyant RJ, et al. “Detection of Streptococcus mutans Genomic DNA in Human DNA Samples Extracted from Saliva and Blood”. ISRN Dentistry. 2011; 1–6.

54. Pmb H, Agnol D, Baraúna RA, Sá PHCG De, Ramos RTJ, Nóbrega F, et al. “Omics profiles used to evaluate the gene expression of Exiguobacterium antarcticum B7 during cold adaptation.” BMC Genomics; 2014;1–12.

Received on 24.12.2019 Modified on 18.02.2020

Research J. Pharm. and Tech. 2021; 14(1):344-350.

DOI: 10.5958/0974-360X.2021.00063.9